Ethylene is the only gaseous phytohormone. It regulates, i.a. primary dormancy breaking, seed germination, fruit ripening, plant ageing, and reaction to stressors.
The biosynthesis of the hormone starts with conversion of the aminoacid methionine to S-adenosyl-L- methionine (SAM). SAM is then converted to 1-aminocyclopropane-1-carboxylic-acid (ACC) by the enzyme ACC synthase (ACS), [EC 4.4.1.14].; the activity of ACS is the rate-limiting step in ethylene production, therefore regulation of this enzyme is key for the ethylene biosynthesis. The ACC is then converted to ethylene by the enzyme ACC oxidase (ACO) [EC 1.4.3].
The aim of this study was to identify genes that encode enzymes taking part in the ethylene biosynthesis pathway, ACC synthase and ACC oxidase, in Amaranthus caudatus L. Knowledge of the gene sequences will enable the analysis of their expression during dormancy breaking and seed germination. It will also enable the modification of the gene expression, which in turn could regulate the level of the ethylene produced by the plant.
In order to identify the aforementioned genes, PCR method was used. The primers were the homological regions of the coding genes ACS and ACO, also present in other plants. One pair of starters was used for the gene ACS, i.e. ACS: ACS6 – F 5`-ATTCAAATGGGTCTCGCTGA -3`, ACS6 – R 5`-GTGACGAAACAAGACCAAAACT -3` and two pairs for the gene ACO, i.e.: ACO-R 5`- GGGTTGTAGAATGAGGCTAT -3`, ACO-F 5`GCTTGTGAGAACTGGGG -3` i ACO3-F 5`-GATTGGGAAAGCACTTTC TTC-3`, ACO3–R 5`-GTGATCACCTCAAGTTGGTC -3`. The template for the PCR reaction was cDNA (cDNA synthesis Kit, ROCHE), obtained from mRNA isolated from 7 day old seedling of Amaranthus caudatus L., (NukleoSpin RNA Plant, NukleonTrap mRNA, MACHEREY-NAGEL). The products of the PCR reaction were then sequenced (AGOWA GmbH, Berlin). The identified gene fragments were compared in the NCBI data base, using BLASTN software.
Sequencing with ACO starters resulted in fragments 620 nucleotides long, with ACO3 – 350 nucleotides long, and with ACS6 - 450 nucleotides long fragments. In silico analysis of the obtained DNA fragments showed high homology (identicity ranging between 80% and 92%) to the coding genes ASC and ACO identified in various plant species. For ACO such homology is characteristic, among others, for: Carnation senescenc, Dianthus caryophyllus, Carica papaya, Prunus domestica, Gossypium barbadense, Nicotiana tabacum, Medicago sativa, Pyrus pyrifolia, Fagus sylvatica, Rosa hybrid, Pisum sativum, Solanum tuberosum, Arabidopsis thaliana, Cucumis sativus, Phaseolus lunatus, Malus domestica. For the ACS gene, such homology is characteristic for: Dianthus caryophyllus, Carica papaya, Vigna radiate, Gossypium hirsutum, Nicotiana tabacum, Fagus sylvatica, Pisum sativum, Solanum tuberosum, Medicago truncatula, Arabidopsis thaliana, Cucumis sativus, Brassica rapa, Malus domestica, Rumex palustris.
The research financed by MNiSW, grant no 3PO6A00425. |